HUMANISM REVISITED

Genes and Memes on a Global Earth

home Claudio Gutierrez home


APPENDIX C - MUTATIONS AND GENETIC DRIFT

Mutation

Mutation is a normally random modification of genetic material which results in a modification of a gene or, in general, any part of the DNA chain. The most frequent mutations, the easiest to be produced, are those which alter a small segment of DNA, replacing one base for another. The factors responsible for mutations are numerous. The simplest to understand is the copy error incurred during DNA replication, notwithstanding the quality controls of the cell. Some others are physical phenomena which somehow alter DNA. Dominant among them are the ultraviolet rays, X rays, and gamma rays. Although mutations can affect whatever cell they may occur in (for instance, they can produce cancer), only those affecting sexual cells have an evolutionary effect. Genetic novelty in the endowment of a species is only induced by cells crossing the border between generations.

A mutation that occurs as a result of a natural process within the cell is identified as spontaneous, to distinguish it from the one resulting from the interaction of DNA with some external agent (mutagenous substances). The most common spontaneous mutations are those that occur during DNA replication. Even though we usually call them copy errors, they are structural and systematic in origin. They actually depend on the tautomerism to which the bases of DNA are subject, a spontaneous structural phenomenon, probably selected for its contribution to the production of diversity, a key factor for the continual functioning of evolution. To be more specific: Two organic substances with the same molecular formula (same number of atoms of equal elements) but different structures (atoms organized in space in relation to each other in different ways) are said to be isomeric. A substance capable of existing in any of two isomeric forms, between which it can inter convert, is described as a tautomer. Guanine, for instance, can exist in the keto and enol forms. The keto-enolic tautomerism corresponds to the displacement of a hydrogen atom which makes the substance alternate between a ketonic function (carbon atom doubly linked to an oxygen atom and to other two carbon atoms, marked as R for radical: ) and an enolic function (a ketonic function whose carbon group has been transformed into a hidroxil group, according to the equation ). The keto form is favored, but the enol can occur because of the leap of a hydrogen from a carbon atom to an oxygen one. Thymine has also its enol form, and adenine and cytosine, on their part, can exist under “imino” or “amino” forms. What is important is that tautomer bases possess different mating properties among themselves, through hydrogen bonds. If, during DNA replication, a G occurs in enol form, polymerase will add a T in front of it, instead of the expected C, not because the polymerase makes a mistake but rather because, in this case, the mating rules are different. The result is a transition from GC to AT, which makes this type of spontaneous mutation be known as transition ones. Another type of spontaneous mutation can occur in a DNA sequences that repeat the same nucleotide many times. For instance, in the paired sequence

5' AGTCAATCCATGAAAAAATCAG 3'
3' TCAGTTAGGTACT T TT T TAGTC 5'
a mutation would most likely occur in the fragment with six pairs of AT bases (3' and 5' refer to the direction of DNA synthesis).350 Several studies have confirmed, in genes of different organisms, that these types of fragments are indeed zones prone to originate spontaneous mutations. This type of spontaneous mutation is picturesquely known as a polymerase “slip.”351

Preadaptation

Mutations can be described as neutral, including those affecting gametes, if they do not have consequences in the life of the organism, even if a particular one alters those parts of DNA that express themselves in protein production. They may well be transmitted from generation to generation and, nevertheless, go unnoticed. However, after their casual appearance, if environmental conditions change, it is possible for a previously neutral mutation to manifest a sudden usefulness in the new environment. Natural selection can then favor their carriers who, when grown to big numbers, will considerably increase the frequency of the mutant gene within the population. This case of neutral mutations suddenly turned advantageous is considered a preadaptation phenomenon. An example would be the case of a population suffering a radical change of environmental conditions. A stage of catastrophic evolution could follow, responsible for a drastic population reduction. In extremis, only the few fortunate carriers of the preadaptive mutation will survive extinction. The population would have to be reborn, starting from the few members lucky enough to have been preadapted to the new conditions. Historic clear illustrations of this phenomenon are the murderous periodical plagues of the Middle Ages.

Genetic Drift

A human individual can generate at least 223 different gametes, being himself the result of the combination of only two from his progenitors'.352 Thus, his own combination is unique among (223)2 crossbreed possibilities between father and mother. This is equivalent to the horrifyingly large number 70368700000000. This figure expresses only the combination possibilities for two specific progenitors. If we talk instead about crossbreed possibilities of the population as a whole, we reach simply unimaginable values. Since the number of births within a population is always small in relation with the possible combinations of the available genetic material, the distribution of traits is bound to vary continuously within the population from generation to generation. This constitutes what is usually called genetic drift, something conceptually altogether distinct from mutation but easily confused with it (Barrette, 1999).

Notes

Note 350: See Appendix E: SENSE AND ANTISENSE IN THE DNA STRANDS.

Note 351: I give thanks to Gabriel Macaya, at the Molecular and Cellular Biology Center in the University of Costa Rica, for helping me notice the systematic character of these mutations. Also to Beth A. Montelone, at the Biology Division of Kansas State University, for making available her excellent syllabus of BIOL400, where I could visualize the relevant mechanisms.

Note 352: Discounting, of course, the effects of recombination between homologous chromosomes. See Chapter 5, THE MACHINERY OF DIVERSITY.

Copyright © 2009 Claudio Gutiérrez